Abstract:
Objective To investigate the clinical features of selenoprotein N1 related myopathy (SEPN1-RM) with sleep-related respiratory insufficiency as the main manifestation.
Methods The clinical materials of a SEPN1-RM child with sleep-related respiratory insufficiency as the main manifestation were analyzed, genomic DNAs in the peripheral blood of the child and her parents were conducted with full exon high throughput sequencing, and a related literature review was carried out as well.
Results For this child, the onset of the disease was insidious and the progress was slow, and the sense of weak was obvious after doing activities; since the age of 8, this child had difficulty in jumping, accompanied by myopathic facial features, scoliosis, sleep-related respiratory insufficiency and restrictive ventilation dysfunction; muscular MR showed extensive muscular atrophy of muscle groups, and electromyography showed myogenic damage. Gene detection found that SEPN1 gene had compound heterozygous variation, which were c.1396 (exon11) C>T (paternal source) and c.156 (exon1)_c.183+7 (IVS1) delCGCCGAGGCCCAGGCGGCCGCGCGGCAGGTCCGGG (maternal source).
Conclusion SEPN1-RM should be considered for children with sleep-related respiratory insufficiency, muscle strength decline, spinal deformity and restrictive ventilation dysfunction. Genetic examination can provide basis for the diagnosis of SEPN1-RM.
下载: